< Back to 68k.news BR front page

The gene "degrees of kevin bacon" (dokb) regulates a social network behaviour in Drosophila melanogaster

Original source (on modern site)

Introduction

Although the mention of social networks often brings to mind digital social media platforms like Facebook and other online communities, the use of social networks to analytically study group behaviour originated in the field of sociology in the 1930s1. Since its inception, social networks have been studied in various animals, from fruit flies2 to elephants3,4. Despite how common it is for animals to form social groups and interact within them, genetic contributions to the structure of group behaviour are still poorly understood. Here, we use the common fruit fly, Drosophila melanogaster, to identify a gene responsible for regulating a social network property, betweenness centrality.

Betweenness centrality, like other measures of centrality, quantifies the importance of individuals in facilitating interactions within a social network and is defined as the number of shortest paths that traverse a node/individual5. In some animals, such as dolphins and rock hyraxes, high measures of centrality correlate to better health outcomes6,7. An individual with high betweenness centrality is thought to be important for cohesion and communication relay throughout a group and can be loosely thought of as a "gatekeeper" for the network (Fig. 1). Depending on what is spreading throughout a social network, having high betweenness centrality may underlie beneficial or detrimental outcomes. For example, having high betweenness centrality in a scientific research network increases potential collaborators8, but in a disease network, it may increase the chance of HIV infection9. Studies have shown that betweenness centrality is likely heritable in several species, including marmots10, macaques11, fruit flies12 and humans13.

Fig. 1: Social network structure and betweenness centrality.

Circles represent nodes (individuals), and the arrowed connections indicate interactions between nodes. Numbers indicate the degree (total number of interactions) for each node. Anything flowing through the network from the yellow nodes on the left to the yellow nodes on the right (or vice versa) must traverse through the blue node. Thus, the blue node has a higher betweenness centrality than the yellow nodes, as the blue node acts as a 'gatekeeper' between the left side and right side of this network.

Betweenness centrality is one structural feature of a social network, although there are many others14. The betweenness centrality of a group guides and constrains how the group may function. For example, the betweenness centrality of a group can influence the spread of a disease, the spread of information or the distribution of food. Similar to mating, courtship and aggression, betweenness centrality only manifests in a social setting. Here, we use Drosophila melanogaster social networks (Supplementary Fig. 1) to identify and manipulate a single gene that regulates betweenness centrality (BC).

Results

Mapping a locus responsible for regulating BC in Drosophila

To identify a gene that regulates betweenness centrality, we began by using an adapted recombinant mapping technique15 and exploited the observation that betweenness centrality is higher in our Canton-S (CS) strain compared to our Oregon-R (OR) strain of Drosophila melanogaster16 (Supplementary Fig. 2). The strain-specific phenotype and mapping method were robust and allowed us to map a betweenness centrality locus within a 474 kb region on the 3L chromosome (Fig. 2a, b; Supplementary Figs. 2 and 3). We identified two genes within this locus that are differentially expressed in the central nervous systems of CS and OR flies: Nplp2 and CG14109 (Supplementary Table 1).

Fig. 2: Mapping the gene that regulates betweenness centrality.

a Left: Visual representation of recombination events on the 3rd chromosome generated through recombination of CS and OR strains of Drosophila as determined by SNP genotyping. OR regions are displayed in grey, CS regions are displayed in orange, unsequenced regions are displayed as a thin black line. Nucleotide position (bp) of chromosome 3 is on the x-axis. Middle: A summary of the betweenness centrality that was calculated from the social networks of different groups of flies. Each dot represents the average betweenness centrality from a network formed by a distinct group of 12 flies. Averages for each genotype are shown by a vertical line. The average betweenness centrality of all CS and OR controls used in the recombinant mapping experiments are displayed as orange and grey dashed lines, respectively. Right: The phenotype of the recombinant lines was determined by comparing the recombinant lines to wild-type controls. See Supplementary Fig. 2 for sample sizes and statistics for all recombinant lines. b The black box represents the region housing gene(s) responsible for regulating betweenness centrality. A higher resolution genotyping using PCR was used to determine where recombination occurred in lines R7, R41 and R199. c and d Pictures representing the creation of CG14109 swap lines. Blue lines = the approximate position of the CS/OR SNPs. Blue star = approximate position of CS/OR SNP that results in a 129Ala → Glu missense mutation. c OR fly with a CS allele of the CG14109 gene (referred to as OR{CG14109+1}). d CS fly with an OR CG14109 allele (referred to as CS{CG14109+2}). e Betweenness centrality of CS wild-type (CS{CG14109+1}) and OR wild-type (OR{CG14109+2}) lines with the two swap lines. Depictions of each line's third chromosome are on the left. Each dot represents the average betweenness centrality from a network formed by a distinct group of 12 flies. Averages for each genotype are shown by a vertical line. Statistical significance is indicated by letters and was determined by a one-way ANOVA, followed by a Tukey-Kramer post hoc test. F(3,77) = 23.71, p = 7.38 × 10−11. CS{CG14109+1}: n = 18, OR{CG14109+2}: n = 21, OR{CG14109+1}: n = 20, CS{CG14109+2}: n = 19. Source data are provided in the Source Data file.

Testing candidate genes, Nplp2 and CG14109, for the regulation of BC

Next, we asked whether either of these genes influence betweenness centrality. To address this question, we knocked down the expression of Nplp2 and CG14109 using the GAL4-UAS system and eliminated the expression of CG14109 by creating a null mutant using CRISPR/Cas9. Both Nplp2 and CG14109 RNAi lines and the CG14109 null mutant had a strong knockdown efficacy (see below). We show that knocking down Nplp2 expression did not affect betweenness centrality, but knocking down or knocking out expression of CG14109 resulted in networks with lower betweenness centrality compared to wild-type controls (see below).

Next, we asked whether CG14109 is responsible for the strain-based difference in betweenness centrality. This gene differs by seven nucleotides between our CS and OR strains, one of which results in a predicted amino acid difference (129Ala→Glu; Fig. 2c, d; Supplementary Fig. 5). However, there are no nucleotide differences in the upstream region of the gene. We used CRISPR/Cas9 to insert the CS CG14109 allele into an OR fly and vice versa (Fig. 2c, d). Networks formed by these flies show that betweenness centrality correlates to the CG14109 donor allele and not the genetic background (Fig. 2e): just as CS wild-type flies form networks with higher betweenness centrality than OR wild-type flies (Fig. 2e; Supplementary Fig. 2; Supplementary Fig. 3), flies with a CS CG14109 allele (CG14109+1) in an otherwise OR background form networks with higher betweenness centrality than flies with an OR CG14109 allele (CG14109+2) in a CS background. These data show that the CG14109 allele rescues the robust strain-based difference observed between our CS and OR strains. Other social behaviours correspond most closely to the genetic background of these lines and not the CG14109 donor allele (Fig. 3a, c, e), although some social behaviour measures did not correspond to either the CG14109 allele or the genetic background (Fig. 3b, d). We conclude that CG14109 regulates betweenness centrality, a metric of group behaviour. We named this gene degrees of kevin bacon (dokb) after the parlor game "Six Degrees of Kevin Bacon" where participants choose an arbitrary Hollywood actor and determine the shortest path that connects that individual to Kevin Bacon via film roles.

Fig. 3: Behavioural properties of CS{CG14109+2} and OR{CG14109+1} flies and their controls.

Each dot represents the average measurement from a network formed by a distinct group of 12 flies. Vertical lines indicate the average measurement for a given genotype. Letters indicate statistical significance, as determined by a one-way ANOVA followed by a Tukey-Kramer post hoc test. a Average movement of flies for each genotype. F(3,82) = 39.10, p = 1.36 × 10−15. CS{CG14109+1}: n = 21, OR{CG14109+2}: n = 21, CS{CG14109+2}: n = 21, OR{CG14109+1}: n = 20. b Average interaction rate of flies for each genotype. F(3,83) = 22.28, p = 1.39 × 10−10. CS{CG14109+1}: n = 22, OR{CG14109+2}: n = 21, CS{CG14109+2}: n = 21, OR{CG14109+1}: n = 20. c Average assortativity of flies for each genotype. F(3,79) = 39.89, p = 1.36 × 10−15. CS{CG14109+1}: n = 22, OR{CG14109+2}: n = 18, CS{CG14109+2}: n = 19, OR{CG14109+1}: n = 21. d Average clustering coefficient of flies for each genotype. F(3,81) = 79.13, p = 1.34 × 10−23. CS{CG14109+1}: n = 22, OR{CG14109+2}: n = 18, CS{CG14109+2}: n = 21, OR{CG14109+1}: n = 21. e Average global efficiency of flies for each genotype. F(3,80) = 31.71, p = 1.34 × 10−23. CS{CG14109+1}: n = 21, OR{CG14109+2}: n = 21, CS{CG14109+2}: n = 19, OR{CG14109+1}: n = 20. Source data are provided in the Source Data file.

dokb expression correlates with social network BC

Next, we asked whether dokb RNA expression correlates with the betweenness centrality phenotype. To do this, we manipulated dokb expression using mutant and transgenic lines and subsequently measured the betweenness centrality of their networks. Knocking out and knocking down dokb expression reduced betweenness centrality (Fig. 4a-c; Supplementary Fig. 6a, b). Additionally, we found that when the dokb+1 allele was inserted into an OR background, dokb was expressed at the same levels as in CS flies, and when the dokb+2 allele was inserted into a CS background, it was expressed at the same levels as in OR flies (Fig. 4d; Supplementary Fig. 6c). The fact that the upstream region of dokb is identical in both strains suggests that differential dokb expression is a result from regulatory elements within the gene itself. Moreover, we show that dokb expression did not decrease in Nplp2 knockdown flies, and the behavioural phenotype did not differ from controls (Fig. 4e; Supplementary Fig. 6d). Taken together, these data demonstrate that dokb RNA expression correlates with betweenness centrality and supports our conclusion that dokb regulates the betweenness centrality phenotype in fly social networks.

Fig. 4: dokb RNA expression and betweenness centrality across genetic lines.

Each dot (no outline) represents the average BC from a network formed by a distinct group of 12 flies. Average BC for each genotype is shown by horizontal lines. Outlined dots connected by a black line represent the average dokb (orange) or Nplp2 (green) expression. A two-tailed t-test was used for all statistical analyses for graph c. For all other graphs, the statistical significance of BC is indicated by black letters and was determined by a one-way ANOVA, followed by a Tukey-Kramer post hoc test. Statistical significance of average gene expression is indicated by Greek letters as determined by a one-way ANOVA, followed by a Tukey-Kramer post hoc test. Error bars indicate ±SE for RNA expression. a dokb expression and BC of genotypes containing two copies of dokb (dokb+2), one copy of dokb (dokb+2/Df(3 L)ED4502 and dokb+2/ dokbn2-GAL4) and no copies of dokb (Df(3L)ED4502/ dokbn2-GAL4). Behaviour: dokb+2: n = 22; dokb+2/Df(3 L)ED4502: n = 19; dokb+2/ dokbn2-GAL4: n = 18; Df(3L)ED4502/ dokbn2-GAL4: n = 12. F(3,70) = 17.41, p = 1.83 × 10−8. dokb RNA Expression: n = 4 for all genotypes. F(3,15) = 47.19, p = 6.52 × 10−7. b Knocking down dokb expression decreases BC. Behaviour: WT Control: n = 21, UAS Control: n = 20, GAL4 Control: n = 19, dokb RNAi Knockdown: n = 22. F(3,81) = 3.81, p = 1.73 × 10−6. dokb RNA Expression: n = 3 for all genotypes. F(3,11) = 89.16, p = 1.73 × 10−6. c dokbn1 flies have no dokb expression and a decrease in BC. Behaviour: dokb+1: n = 22; dokbn1: n = 18. t17 = 5.74, p = 2.37 × 10−5. dokb RNA Expression: n = 4 for each genotype. t3 = 3.01 × 103, p = 8.01 × 10-11. d dokb expression correlates to the dokb allele. Behaviour: data is the same as in Fig. 2e (see figure legend). dokb RNA Expression: n = 4 for each genotype. F(3,15) = 16.86, p = 1.33 × 10−4. e BC and dokb RNA expression levels (orange dots with outlines connected by a black line) remain stable in Nplp2 RNAi knockdown flies and controls. Nplp2 expression is reduced in Nplp2 RNAi knockdown flies (green dots with outline connected by a black line). Behaviour: GAL4 Control: n = 21; UAS Control: n = 20; Nplp2 Knockdown: n = 24. Data is n.s (p = 0.42). dokb RNA Expression: n = 3 for each genotype. Data is n.s. (p = 0.23). Nplp2 RNA Expression: n = 3 for each genotype. F(2,8) = 103, p = 2.21 × 10−5. Source data are provided in the Source Data file.

Deleting dokb changes hydrocarbon profiles in a strain-specific way

Given that betweenness centrality is a group-level behaviour and social interactions among Drosophila conspecifics are primarily mediated by detecting hydrocarbons17,18,19, we next investigated whether deleting dokb leads to modified hydrocarbon profiles. In a CS background, dokb nulls (dokbn1) showed an increase in alkanes, methyl alkanes and total hydrocarbon amounts, but there was no effect of deleting dokb on total alkene production (Supplementary Fig. 7a-d). In an OR background, dokb null flies (dokbn2) had reduced alkenes, alkanes and total hydrocarbon amounts and increased methyl alkanes (Supplementary Fig. 7a-d). dokb nulls of either strain showed no effect on cVA production, a compound previously shown to cause aggregation and dispersal in Drosophila20,21,22,23,24 (Supplementary Fig. 7e). To investigate whether dokb can influence the production of hydrocarbons directly, we next asked whether dokb is expressed in the oenocytes, the cells that synthesize cuticular hydrocarbons in Drosophila and other insects, using qPCR and a dokb GFP reporter. The oenocytes expressed extremely low levels of dokb with most of our replicates failing to detect any dokb at all (Supplementary Table 2). No GFP was detected in the oenocytes (Fig. 5d); however, GFP was detected in adult somatic muscle tissue including, but not limited to, the dorsal lateral muscles (Fig. 5a, b), the alary muscles (Fig. 5c, d) and larval body wall muscles (Fig. 5e). Taken together, our data show that deleting dokb results in changes to hydrocarbon profiles but dokb is not reliably detected in the oenocytes, suggesting it does not directly affect hydrocarbon production. These results are consistent with previous findings, that group composition can affect hydrocarbon profiles and gene expression independent of genotype18,25. Thus, we favour the hypothesis that changes in hydrocarbon profiles in dokb null mutants are a consequence of their social experience; i.e. differences in their social network structure.

Fig. 5: Expression of dokb using dokbn2-GAL4 line and a GFP reporter in adult and larval muscle tissue.

dokbn2-GAL4 expression patterns reported by a UAS-GFP reporter (green). Scale bars are shown at the bottom. a and b Sagittal section through the adult thorax exposing the indirect flight muscles. Reporter: UAS-StingerII. a Brightfield image showing the dorsal lateral muscle (DLM). thx = thorax; abd = abdomen. b Fluorescent image showing the DLM. The same preparation is shown in a and b. Other muscles of the thorax and legs were also labelled but are out of the plane of focus. c and d Fillet preparation of the adult abdomen. c Brightfield image showing the tissues associated with the internal surface of the abdominal cuticle. d GFP is expressed in the abdominal body wall muscles and alary muscles of all abdominal segments (segments A3-A5 are shown). GFP expression was not detected in the oenocytes. The ventral surface abdomen was bisected (located on the lateral edges of the image) to expose the internal surface of the dorsal cuticle. The same preparation is shown in c and d. Reporter: UAS-StingerII. e Fluorescent image of a fillet preparation of a 3rd instar larval cuticle showing the body wall muscles. Reporter: UAS-mCD8-GFP. For each preparation, n ≥ 2.

dokb is expressed in larval and adult muscle tissue and the CNS

To determine where dokb is expressed in the Drosophila central nervous system (CNS), we crossed our dokbn2-GAL4 line to a fluorescent reporter. dokb expression in the larval central brain begins in the 2nd instar larval stage and persists into adulthood (Supplementary Fig. 8, Fig. 6). In the 3rd instar larval CNS, GFP was detected in the mushroom body calyces, the ventral nerve cord, the eye/antennal disc and leg discs (Supplementary Fig. 9). In the adult male CNS, GFP was detected in the gamma lobes and calyces of the mushroom bodies, as well as the suboesophageal ganglion and ventral nerve cord (Fig. 6). The Drosophila mushroom bodies have been shown to play a critical role in olfactory learning and memory26,27,28,29 and are connected to several primary sensory centres, including the olfactory antennal lobe, visual optic lobe and the gustatory suboesophageal zone30. The gamma lobes of the mushroom bodies have been shown to play a role in social attraction and in forming short-term memories in Drosophila31,32,33,34,35 (Fig. 6a-c, f, g). In the ventral nerve cord, GFP is expressed in the ventral and intermediate regions of the prothoracic, mesothoracic and metathoracic neuromeres36, which are regions innervated by neurons associated with the legs37 and regions serving to link legs and wing control38, respectively. GFP expression is also evident in the accessory mesothoracic neuropil, which is associated with sensory afferents from the wing and notum36,39 (Fig. 6a-c). Taken together, we demonstrate that dokb expression begins in the larval stage and occurs in tissue-specific regions within the larval and adult central brain and ventral nerve cord. In adults, dokb expression patterns coincide with tissues related to olfactory learning, locomotion and motor control. Given that dokb regulates a complex group-level behaviour, it is noteworthy that this gene's expression pattern suggests a potential circuit that includes neurons associated with sensory processing, sensory-motor integration and motor output.

Fig. 6: Expression of dokb using dokbn2-GAL4 line and a GFP reporter in the adult CNS.

dokbn2-GAL4 expression patterns reported by UAS-mCD8.GFP (green). Immunostained with anti-nc82 antibody (magenta). Scale bars are indicated at the bottom. a-c Z-progression through the brain (anterior to posterior) and ventral nerve cord (ventral to dorsal). d and e Z-progression through the AL, VLP and SOG (anterior to posterior). Note the staining in the ventral-medial glomeruli of the AL. f and g Z-progression through the MB γ lobes (f) and calyces (g). MB mushroom body, VLP ventrolateral protocerebrum, AL antennal lobe, Me medulla, SOG suboesophageal ganglion, ProNm prothoracic neuromere, AMNp accessory mesothoracic neuropil, MesoNm mesothoracic neuromere, MetaNm metathoracic neuromere. n ≥ 5.

dokb +1 and dokb +2 are natural variants

We have identified two alleles of dokb associated with distinct laboratory wild-type strains. We asked whether these two alleles are an artefact of captivity or, alternatively, may represent naturally occurring variants. The identification of such allelic variation in the wild could indicate an adaptive advantage. To investigate whether these allelic differences are found in nature, we examined the dokb sequence of various wild-caught D. melanogaster strains from PopFly40 (Supplementary Fig. 10a). We analysed the frequency of cytosine and adenine at dokb's 1049th nucleotide, which accounts for the alanine to glutamic acid change in our CS and OR laboratory strains, respectively. We found that adenine occurs at this position in 6.5% of the samples analysed from 30 strains taken from five continents around the world (Supplementary Table 3). In addition, we found that the distribution of adenine across the different strain samples is unevenly distributed [X2(28, N = 49) = 369.16, p < 0.001], with a higher frequency of adenine occurring in various strains collected from lower elevations (Supplementary Fig. 10b). Based on these observations, we conclude that these dokb alleles exist in the wild and show that the laboratory strains used in our experiments retain this natural variation.

Discussion

By taking a social network approach to study groups of flies, we and others have characterized differences in group structure across strains within the melanogaster species2. There are many examples of strain-based distinctions in Drosophila, encompassing diversity in mating strategies41, pheromonal profiles42,43,44, biological clocks45, taste reception46, and learning abilities47,48. Our paper shows that a single gene, dokb, is sufficient to regulate a specific behavioural feature of social networks, betweenness centrality. Allelic differences of dokb within laboratory strains modulate betweenness centrality. In addition, we found identical alleles in wild populations, with the dokb+2 allele occurring at a relatively low frequency. Other low-frequency alleles have been reported to confer an adaptive advantage in certain populations. For example, the sickle haemoglobin (HbS) allele, a structural variant of normal haemoglobin, occur with varying frequencies in different populations, with higher HbS frequencies in regions with higher instances of malaria49. Similarly, we speculate that these two dokb alleles confer an adaptive value of social structure within the species and that, given the unequal distribution of the two alleles across elevation, the population benefits from having higher frequencies of the dokb+2 allele at lower elevations, although further investigation is required to determine what that advantage may be. Identifying this genetic variant is invaluable for investigating the evolutionary processes underlying group behaviour.

Although group-level social behaviour is a general feature of animal life, the molecular evolution of social networks and collective behaviours have not been well characterized. Surprisingly, we found no DNA or protein sequence homology of dokb outside of the Diptera order, nor did we find any conserved domains within the predicted CS and OR DOKB protein sequences. Nevertheless, in instances of convergent evolution, conservation often manifests at the pathway level rather than through identical gene sequences. For example, caste phenotypes in eusocial insects, including bees, ants, and wasps, have been associated with conserved metabolic pathways, such as the glycolysis pathway, rather than specific genes50. We anticipate that the molecular pathways and/or functional cell circuitry with which dokb is involved will be conserved in other animals. Numerous studies suggest genetic contributions to the structure of social networks10,11,12, including for betweenness centrality in humans13, indicating the potential for a conserved pathway. The functional roles and biological pathways associated with dokb and its encoded protein can now be directly addressed.

Methods

Fly Rearing

All fly strains were reared on a medium containing agar, glucose, sucrose, yeast, cornmeal, wheat germ, soya flour, molasses, propionic acid and Tegosept in a 12:12 h light/dark cycle at 25 °C. For network experiments, newly-eclosed adult males were collected using CO2 anaesthesia and were kept in same-sex groups of 12-16 flies in food vials and aged for 3 days. Experiments were run between 9 and 10.5 h after the lights were on.

Fly Lines

Canton-S (CS) and Oregon-R (OR) wild-type flies were obtained from J. C. Hall (Emeritus at Brandeis University, Waltham, MA). Introgression and recombinant lines were generated through a series of crosses from these wild-type lines. Recombinant lines had OR as their X and 2nd chromosome and an OR recombined with CS as their 3rd chromosome.

+;+;dokbn2-GAL4, dokbn1, CS(dokb+2), dokbn2 and OR(dokb+1) were generated using CRISPR/Cas9 in collaboration with WellGenetics Inc. Lines were verified with DNA sequencing.

dokb null lines (dokbn1, dokbn2 and dokbn2-GAL4) were generated such that the 980 bp coding sequence (+16 nt from ATG to −85 nt from stop codon of dokb) was deleted and replaced with a Stop-RFP cassette with 3-frames of stop codons and a 3XP3-RFP, except for the dokbn2-GAL4 line which was replaced by a T2A-GAL4::VP16 cassette and 3XP3-RFP.

For the CS(dokb+2) and OR(dokb+1) swap lines, the entire gene region of dokb, from the promoter to the 3'UTR (1960bp) in one strain, was deleted and replaced by the gene region from the other strain with an inverted PBacDsRed marker inserted into the 2nd intron of dokb. The marker was excised before lines were used in behavioural experiments.

The CG14109 deficiency null was generated by selecting progeny from crossing virgin +;+;dokbn2-GAL4 females to deficiency males (w[1118]; Df(3L)ED4502, P{w[+mW.Scer\FRT.hs3] = 3'.RS5 + 3.3'}ED4502/TM6C, cu[1] Sb[1]; Bloomington Stock Center Line #8097).

The Nplp2 RNAi knockdown flies were generated by selecting progeny from crossing Nplp2-GAL4 line (w[1118] (I); P{w[+mC] = Nplp2-GAL4}vie72a (II); Korean Drosophila Resource Center Line #10023) to the UAS-Nplp2 RNAi line (y[1] v[1]; P{y[+t7.7] v[+t1.8] = TRiP.HMJ21484}attP40; Bloomington Stock Center Line #54041).

Genetic mapping

To map the locus containing the gene responsible for regulating BC in flies, we based our method on Chen et al.15 but adapted their method to suit our assay and fly strain requirements. We began by assessing the BC of our introgression lines and determined that there was a gene(s) on the 3rd chromosome responsible for regulating BC (Supplementary Fig. 2a). Next, we sequenced the genomes of our CS and OR lab strains: ~3 µg of gDNA was collected from male and female CS and OR whole flies using Zymo Research ZR Tissue and Insect DNA Miniprep Kit (#D6016) and supplied to The Centre for Applied Genomics (TCAG; Toronto, ON, Canada) for high-throughput sequencing (Illumina HiSeq 2500).

We subsequently generated a high-resolution SNP map [Clinical Genomics Centre (Toronto, ON, Canada)] by identifying polymorphisms between the two strains at a resolution of approximately 60 equally spaced SNPs on each chromosome 3 arm.

We generated recombinant lines through a series of genetic crosses that resulted in flies that had an OR X and 2nd chromosome and a recombined CS/OR 3rd chromosome. Instead of phenotyping our recombinant lines first [as was done in Chen et al.15], we genotyped our recombinants to determine which regions of the chromosome were OR and which were CS. The gDNA samples of recombinant lines were supplied to the Clinical Genomics Centre (Toronto, ON, Canada) for genotyping.

Then, we strategically chose lines to phenotype based on their recombination events. If the BC phenotype of a given recombinant line was statistically the same as the CS control, we concluded that the CS region of that 3rd chromosome housed the gene(s) responsible for regulating BC and, alternatively, if the BC phenotype of a given recombinant line was statistically the same as the OR control, we concluded that the OR region of that 3rd chromosome housed the gene(s) responsible for regulating BC. Using this method, we narrowed the locus to a ~1.2 MB region (Fig. 2a).

We further narrowed and mapped the locus using SNPs within this 1.2 MB region and in-house PCR to genotype more recombinant lines. Ultimately, using this method, we narrowed the locus to 474 kb (Fig. 2b).

Anti-dokb antibodies

Antibodies were raised in New Zealand rabbits against the synthesized peptide VRQSTEEEEVQSHV, which corresponds to amino acid positions 61-74 in the CG14109 protein. The resulting antibody preparation was termed anti-CG14109_AA_61-74. All peptide synthesis and antibody production were performed by GenScript (Piscataway, NJ, USA) using the PolyExpress polyclonal antibody express service.

Protein extraction and Western Blot

Proteins from 15 male and 15 female fly heads per genotype were homogenized in lysis buffer, incubated on ice for 1 h, and centrifuged at 4 °C for 10 min. The supernatant was mixed with 2× Laemmli Sample Buffer (Bio-Rad, #1610737) and placed in a heating block (110 °C) for 15 min. Samples were loaded into a 4-20% Mini-PROTEAN® TGX™ Precast Protein Gel (Bio-Rad, #4561094). Proteins were transferred to a PVDF membrane using the Trans-Blot Turbo Transfer System (Bio-Rad). Blocking was performed using a 5% milk solution at 4 °C overnight. The membrane was incubated in a 5% milk solution + anti-CG14109_AA_61-74 antibody (1:1000) for 2 h at RT with gentle agitation. The membrane was washed three times using 1X PBS for 5 min. then incubated with a 5% milk solution + secondary antibody for 1 h at RT with gentle agitation. The membrane was washed three times using 1X PBS for 5 min and was subsequently exposed to Clarity Western ECL Substrates (Bio-Rad, #1705061) and imaged using a ChemiDoc Imaging Station (Bio-Rad).

Social networks

Twelve male flies were gently aspirated into a circular plexiglass arena (60 mm diameter, 3 mm depth) and covered with a glass lid. The arena was placed under a FireflyMV camera (Point Gray) with an infra-red backlight in a 25 °C environmental chamber at 60% humidity. Flies were allowed to acclimate in the arena for 10 min. undisturbed. The subsequent 30 min. were recorded using fview51. The 30 min video was processed using Ctrax (v 0.5.13)52 to determine the position and orientation of each fly. Each video was manually inspected, and tracking errors were corrected for each video using fixerrors52. Approximately 20 videos were used per genotype.

The social interaction criteria for all gene mapping experiments (introgression and recombinant experiments) were the same as the criteria used in Schneider et al.16, and are described as follows:

  1. (a)

    the angle subtended by the long axis of the interactor fly and the line segment connecting the interactor fly's center of area to that of the interactee fly is less than or equal to 90°

  2. (b)

    the length of that line segment is less than or equal to two body lengths of the interactor fly

  3. (c)

    these two conditions are maintained for at least 1.5 s

In 2014, a new method was proposed by Schneider and Levine to objectively and computationally determine the interaction criteria for a given genotype. Using such methods allows researchers to assess social networks while controlling for the different ways that a genotype may interact. After the software's creation, we used this method to determine the interaction criteria for all subsequent experiments for all other genotypes (excludes recombinant and introgression experiments; see Supplementary Table 4)53.

Directed social networks were generated by calculating iterative networks using a moving-window boxcar filter at 25% network density (33 unique interactions), as detailed in Schneider et al.16,54. An interaction was considered unique if the interactor had not previously interacted with the other fly. The first network iteration represents the first 33 unique interactions, the second network iteration ignores the first unique interaction and adds a subsequent unique interaction…the ith network iteration ignores the first i−1 interactions. For n network iteration, the betweenness centrality (BCn) was determined by averaging the BC of all twelve flies. Betweenness centrality for each node (fly) was determined using the Brain Connectivity Toolbox MATLAB (Mathworks, v2014a) scripts55, and was calculated using Eq. (1):

$${{\rm {BC}}}\left(v\right)=\mathop{\sum}\limits_{s,t:s\ne v\ne t}\frac{{\lambda }_{{st}}\left(v\right)}{{\lambda }_{{st}}}$$

(1)

where the BC for node v [BC(v)] is the sum of the total number of shortest paths between nodes s and t that pass through v [(\({\lambda }_{{st}}\left(v\right)\)] divided by the number of shortest paths from nodes s to t [\({\lambda }_{{st}}\)]. Each network iteration's average BC was standardized for degree distribution. For each iteration, 10,000 random networks with the same in- and out-degree distribution were generated and each random network's BC was calculated. A z score was determined using Eq. (2):

$$\frac{B{C}_{observed}-mean(B{C}_{random})}{std(B{C}_{random})}$$

(2)

The BC z scores for all iterations from a single 30 min. network was averaged to generate a mean BC for a single experiment, represented as a single dot in a dot plot graph showing betweenness centrality. In other words, each network (or n = 1) indicates the mean z score BC from an independent group of 12 flies that were discarded after the 30-min network experiment was acquired. For each experimental group, we acquired videos from ~20 independent groups of flies (n = ~20 for each treatment).

For networks involving the CS{dokb+2} and OR{dokb+1} flies and their controls, movement (mm/s) and interaction rate (# interactions/min.) were calculated, along with three additional network properties: assortativity, clustering coefficient and global efficiency. All network properties were calculated and standardized as described above and in Schneider et al.16.

qPCR

To determine whether dokb expression correlates to BC, RNA was extracted from whole male flies using RNeasy Micro kit (Qiagen). cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad) and RT-PCR was performed using a CFX384 Real-Time System (Bio-Rad) and iTaq Universal SYBR Green Supermix (Bio-Rad). Each experiment was performed three times (biological replicates) and contained three technical replicates/samples. The reference gene used to normalize each sample was RpL32.

To detect whether dokb was expressed in pheromone-synthesizing cells, oenocytes were dissected from 40 w[1118]; nSyb-GAL4/+; +/+ flies (aged to 10 days) and pooled into a single biological sample. RNA extraction, cDNA synthesis and qPCR methods were as described above.

Primer sequences for detecting levels of dokb are as follows: 5' GCGAGCGCCTAGCTGC and 5' ATTCTCTTCTTGGGCACTCTCTACGG. Primer sequences for detecting levels of Nplp2 are as follows: 5' ATGGCCAAGCTCGCAATTTG and 5' GTTGAAATCACCCTGGGCCT.

RNAseq

CNS dissections and extractions were performed three times to produce three biological replicates. The protocol was as follows: CS and OR male flies housed in 12:12 h light/dark cycle at 25 °C in groups of 12 male individuals/vial. Three CNS dissections were performed over four time points for each genotype (total: 12 CNS/genotype). The CNS samples for each genotype were pooled. RNA was extracted using Qiagen RNeasy Microkit. RNA sequencing was performed on Illumina HiSeq 2000 by VANderbilt Technologies for Advanced Genomics (VANTAGE, Nashville, TN). RNA samples were prepared using Illumina TruSeq Stranded mRNA-seq kit and sequenced at paired-end 50 bp with a target of ~25 M reads/sample. The raw RNAseq data have been deposited in the NCBI's SRA database under accession code PRJNA1082663.

Cuticular hydrocarbon extraction

Flies were sedated on ice and a single fly was added to a microvial containing 50 µl of hexane containing 10 ng/μl of octadecane (C18) and 10 ng/μl of hexacosane (nC26) as injection standards. Tubes were gently vortexed for 2 min. Flies were removed and samples were stored at −20 °C prior to analysis. Extracts that were obtained from 40 to 50 individuals per genotype and examined by gas chromatography.

Immunohistochemistry

For detecting dokb-GAL4 expression across larval development in a central brain lobe, appropriately aged larval CNS samples were fixed with 4% paraformaldehyde for 20 min. at RT. The 1° antibody, rabbit anti-GFP (Cell Signaling Technology, #2956), was applied at 1:1000 and the counterstaining antibody, mouse anti-DN-cad (Cell Signaling Technology, #14215), was applied at a 1:5 concentration. Alex Fluor 488 Donkey Anti-Rb IgG (H + L) (Invitrogen, #A32790) and Alex Fluor 555 Donkey Anti-Rb IgG (H + L) (Invitrogen, # A31572) were applied at a 1:500 concentration.

For detecting dokb-GAL4 expression in the larval and adult CNS, samples were fixed in 4% paraformaldehyde for 20 min. at RT. Samples were labelled with rabbit anti-GFP.Alexa 488 conjugate (1:400; Invitrogen, # A21311) and counterstained with primary mouse anti-Brp (nc82) (1:40; DSHB) and secondary donkey anti-mouse Alexa 647 (1:400; Invitrogen, #A31571). Wandering 3rd instar male larvae were used. Adult male flies were aged 3-4 days old.

All images were obtained from a Zeiss LSM880 microscope.

Imaging of muscular tissue

For imaging the adult thorax and abdomen, a UAS-nuclear GFP reporter was used (UAS-StingerII56. The reporter line was crossed to the dokbn2-GAL4 line. Male progeny were collected, and their abdomens were filleted for imaging. For larval images, a UAS-mCD8.GFP reporter was used, and 3rd instar larvae were filleted to expose the abdominal wall muscles. In the adult and larval muscle, expressed GFP was directly imaged. Images were obtained using a Zeiss Stereo Discovery V.12 microscope.

Sequence homology searches

The DNA and protein sequences of dokb were retrieved from www.flybase.com using CG14109 as the query. BlastN and BlastP searches were performed at NCBI using default setting. Conserved domain searches for the CS and OR DOKB putative protein were performed at https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi using default search settings.

Natural variant data and analyses

966 sequences of Drosophila melanogaster from 30 localities were downloaded from PopFly40. 215 sequences were removed due to nucleotide ambiguity of dokb's 1049th nucleotide position. The frequency of each nucleotide at this position was manually tallied.

The world map depicting the various locations from which each strain was collected and created in MATLAB (MathWorks, v2023b). The longitude and latitude data for each location used to create the map and the elevation of each locality was downloaded from PopFly40.

The chi-square test was performed manually in Microsoft Excel.

Statistical analyses

ANOVA and T-tests were performed using MATLAB (MathWorks, v2014a). For all network experiments, outliers ≥75th quartile + (1.5 × IQR) or ≤ 25th quartile−(1.5 × IQR) were removed before statistical testing. All network experiments were statistically analysed with ɑ = 0.05, except for the dokb swap experiment (Fig. 2c, d), where multiple measurements were assessed using the same data set (Bonferroni correction such that ɑ = 0.008) and the hydrocarbon experiment (Supplementary Fig. 7, Bonferroni correction such that ɑ = 0.01.)

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Source data is available as a source data file. This file contains all behavioural, hydrocarbon and qPCR data generated in this study. The raw RNAseq data have been deposited in the NCBI's SRA database under accession code PRJNA1082663 Natural variant data from strains of Drosophila melanogaster were acquired from the PopFly database (https://popfly.uab.cat/)40. Source data are provided in this paper.

Code availability

Code is available upon request.

References

  1. Freeman, L. C. The Development of Social Network Analysis: A Study in the Sociology of Science. (Empirical Press, Vancouver (B.C.), 2004).

  2. Jezovit, J. A., Alwash, N. & Levine, J. D. Using flies to understand social networks. Front. Neural Circuits 15, 755093 (2021).

    Article  PubMed  PubMed Central  Google Scholar 

  3. Shizuka, D. & Johnson, A. E. How demographic processes shape animal social networks. Behav. Ecol. 31, 1-11 (2020).

    Article  Google Scholar 

  4. Archie, E. A. & Chiyo, P. I. Elephant behaviour and conservation: social relationships, the effects of poaching, and genetic tools for management. Mol. Ecol. 21, 765-778 (2012).

    Article  PubMed  Google Scholar 

  5. Freeman, L. C. A set of measures of centrality based on betweenness. Sociometry 40, 35-41 (1977).

    Article  Google Scholar 

  6. Barocas, A., Ilany, A., Koren, L., Kam, M. & Geffen, E. Variance in centrality within rock hyrax social networks predicts adult longevity. PLOS ONE 6, e22375 (2011).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  7. Stanton, M. A. & Mann, J. Early social networks predict survival in wild bottlenose dolphins. PLoS ONE 7, e47508 (2012).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  8. Abbasi, A., Hossain, L. & Leydesdorff, L. Betweenness centrality as a driver of preferential attachment in the evolution of research collaboration networks. J. Informetr. 6, 403-412 (2012).

    Article  Google Scholar 

  9. Gyarmathy, V. A., Caplinskiene, I., Caplinskas, S. & Latkin, C. A. Social network structure and HIV infection among injecting drug users in Lithuania: gatekeepers as bridges of infection. AIDS Behav. 18, 505-510 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  10. Lea, A. J., Blumstein, D. T., Wey, T. W. & Martin, J. G. A. Heritable victimization and the benefits of agonistic relationships. Proc. Natl Acad. Sci. USA 107, 21587-21592 (2010).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  11. Brent, L. J. N. et al. Genetic origins of social networks in rhesus macaques. Sci. Rep. 3, 1042 (2013).

    Article  PubMed  PubMed Central  Google Scholar 

  12. Wice, E. W. & Saltz, J. B. Selection on heritable social network positions is context-dependent in Drosophila melanogaster. Nat. Commun. 12, 3357 (2021).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  13. Fowler, J. H., Dawes, C. T. & Christakis, N. A. Model of genetic variation in human social networks. Proc. Natl Acad. Sci. USA 106, 1720-1724 (2009).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  14. Newman, M. E. J. Networks: An Introduction (Oxford University Press, Oxford; New York, 2010).

  15. Chen, D. et al. High-resolution, high-throughput SNP mapping in Drosophila melanogaster. Nat. Methods 5, 323-329 (2008).

    Article  CAS  PubMed  Google Scholar 

  16. Schneider, J., Dickinson, M. H. & Levine, J. D. Social structures depend on innate determinants and chemosensory processing in Drosophila. Proc. Natl Acad. Sci. USA 109, 17174-17179 (2012).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  17. Wyatt, T. D. Pheromones and Animal Behavior: Chemical Signals and Signatures. (Cambridge University Press, 2014).

  18. Krupp, J. J. et al. Social experience modifies pheromone expression and mating behavior in male Drosophila melanogaster. Curr. Biol. 18, 1373-1383 (2008).

    Article  CAS  PubMed  Google Scholar 

  19. Billeter, J.-C., Atallah, J., Krupp, J. J., Millar, J. G. & Levine, J. D. Specialized cells tag sexual and species identity in Drosophila melanogaster. Nature 461, 987-991 (2009).

    Article  ADS  CAS  PubMed  Google Scholar 

  20. Wertheim, B., Dicke, M. & Vet, L. E. M. Behavioural plasticity in support of a benefit for aggregation pheromone use in Drosophila melanogaster. Entomol. Exp. Appl. 103, 61-71 (2002).

    Article  CAS  Google Scholar 

  21. Bartelt, R. J., Schaner, A. M. & Jackson, L. L. cis-Vaccenyl acetate as an aggregation pheromone in Drosophila melanogaster. J. Chem. Ecol. 11, 1747-1756 (1985).

    Article  CAS  PubMed  Google Scholar 

  22. Xu, P., Atkinson, R., Jones, D. N. M. & Smith, D. P. Drosophila OBP LUSH is required for activity of pheromone-sensitive neurons. Neuron 45, 193-200 (2005).

    Article  CAS  PubMed  Google Scholar 

  23. Wang, L. & Anderson, D. J. Identification of an aggression-promoting pheromone and its receptor neurons in Drosophila. Nature 463, 227-231 (2010).

    Article  ADS  CAS  PubMed  Google Scholar 

  24. Lebreton, S. et al. Love makes smell blind: mating suppresses pheromone attraction in Drosophila females via Or65a olfactory neurons. Sci. Rep. 4, 7119 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  25. Kent, C., Azanchi, R., Smith, B., Formosa, A. & Levine, J. D. Social context influences chemical communication in D. melanogaster Males. Curr. Biol. 18, 1384-1389 (2008).

    Article  CAS  PubMed  Google Scholar 

  26. Connolly, J. B. et al. Associative learning disrupted by impaired Gs signaling in Drosophila mushroom bodies. Science 274, 2104-2107 (1996).

    Article  ADS  CAS  PubMed  Google Scholar 

  27. Roman, G. & Davis, R. L. Molecular biology and anatomy of Drosophila olfactory associative learning. BioEssays 23, 571-581 (2001).

    Article  CAS  PubMed  Google Scholar 

  28. Davis, R. L. Mushroom bodies and Drosophila learning. Neuron 11, 1-14 (1993).

    Article  CAS  PubMed  Google Scholar 

  29. Zars, T., Fischer, M., Schulz, R. & Heisenberg, M. Localization of a short-term memory in Drosophila. Science 288, 672-675 (2000).

    Article  ADS  CAS  PubMed  Google Scholar 

  30. Yagi, R., Mabuchi, Y., Mizunami, M. & Tanaka, N. K. Convergence of multimodal sensory pathways to the mushroom body calyx in Drosophila melanogaster. Sci. Rep. 6, 29481 (2016).

    Article  ADS  PubMed  PubMed Central  Google Scholar 

  31. Sun, Y. et al. Social attraction in Drosophila is regulated by the mushroom body and serotonergic system. Nat. Commun. 11, 5350 (2020).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  32. Vogt, K. et al. Shared mushroom body circuits underlie visual and olfactory memories in Drosophila. eLife 3, e02395 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  33. Isabel, G., Pascual, A. & Preat, T. Exclusive consolidated memory phases in Drosophila. Science 304, 1024-1027 (2004).

    Article  ADS  CAS  PubMed  Google Scholar 

  34. Blum, A. L., Li, W., Cressy, M. & Dubnau, J. Short- and long-term memory in Drosophila require cAMP signaling in distinct neuron types. Curr. Biol. 19, 1341-1350 (2009).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Trannoy, S., Redt-Clouet, C., Dura, J.-M. & Preat, T. Parallel processing of appetitive short- and long-term memories In Drosophila. Curr. Biol. 21, 1647-1653 (2011).

    Article  CAS  PubMed  Google Scholar 

  36. Court, R. et al. A systematic nomenclature for the Drosophila ventral nerve cord. Neuron 107, 1071-1079.e2 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Merritt, D. J. & Murphey, R. K. Projections of leg proprioceptors within the CNS of the fly Phormia in relation to the generalized insect ganglion. J. Comp. Neurol. 322, 16-34 (1992).

    Article  CAS  PubMed  Google Scholar 

  38. Namiki, S., Dickinson, M. H., Wong, A. M., Korff, W. & Card, G. M. The functional organization of descending sensory-motor pathways in Drosophila. eLife 7, e34272 (2018).

    Article  PubMed  PubMed Central  Google Scholar 

  39. Power, M. E. The thoracico-abdominal nervous system of an adult insect, Drosophila melanogaster. J. Comp. Neurol. 88, 347-409 (1948).

    Article  CAS  PubMed  Google Scholar 

  40. Hervas, S., Sanz, E., Casillas, S., Pool, J. E. & Barbadilla, A. PopFly: the Drosophila population genomics browser. Bioinformatics 33, 2779-2780 (2017).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Billeter, J.-C., Jagadeesh, S., Stepek, N., Azanchi, R. & Levine, J. D. Drosophila melanogaster females change mating behaviour and offspring production based on social context. Proc. R. Soc. B Biol. Sci. 279, 2417-2425 (2012).

    Article  Google Scholar 

  42. Jallon, J.-M. A few chemical words exchanged by Drosophila during courtship and mating. Behav. Genet. 14, 441-478 (1984).

    Article  CAS  PubMed  Google Scholar 

  43. Jallon, J.-M. & David, J. R. Variation in cuticular hydrocarbons among the eight species of the Drosophila melanogaster subgroup. Evolution 41, 294 (1987).

    PubMed  Google Scholar 

  44. Cortot, J., Farine, J.-P., Ferveur, J.-F. & Everaerts, C. Aging-related variation of cuticular hydrocarbons in wild type and variant Drosophila melanogaster. J. Chem. Ecol. 48, 152-164 (2022).

    Article  CAS  PubMed  Google Scholar 

  45. Hamasaka, Y., Suzuki, T., Hanai, S. & Ishida, N. Evening circadian oscillator as the primary determinant of rhythmic motivation for Drosophila courtship behavior: evening oscillator for courtship behavior. Genes Cells 15, 1240-1248 (2010).

    Article  CAS  PubMed  Google Scholar 

  46. Ueno, K. et al. Trehalose sensitivity in Drosophila correlates with mutations in and expression of the gustatory receptor gene Gr5a. Curr. Biol. 11, 1451-1455 (2001).

    Article  CAS  PubMed  Google Scholar 

  47. Hay, D. A. Strain differences in maze-learning ability of Drosophila melanogaster. Nature 257, 44-46 (1975).

    Article  ADS  CAS  PubMed  Google Scholar 

  48. Durcan, M. J. & Fulker, D. W. A comparative study of two Drosophila learning tasks. Behav. Genet. 13, 179-190 (1983).

    Article  CAS  PubMed  Google Scholar 

  49. Piel, F. B. et al. Global distribution of the sickle cell gene and geographical confirmation of the malaria hypothesis. Nat. Commun. 1, 104 (2010).

    Article  ADS  PubMed  Google Scholar 

  50. Berens, A. J., Hunt, J. H. & Toth, A. L. Comparative transcriptomics of convergent evolution: different genes but conserved pathways underlie caste phenotypes across lineages of eusocial insects. Mol. Biol. Evol. 32, 690-703 (2015).

    Article  CAS  PubMed  Google Scholar 

  51. Straw, A. D. & Dickinson, M. H. Motmot, an open-source toolkit for realtime video acquisition and analysis. Source Code Biol. Med. 4, 5 (2009).

    Article  PubMed  PubMed Central  Google Scholar 

  52. Branson, K., Robie, A. A., Bender, J., Perona, P. & Dickinson, M. H. High-throughput ethomics in large groups of Drosophila. Nat. Methods 6, 451-457 (2009).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  53. Schneider, J. & Levine, J. D. Automated identification of social interaction criteria in Drosophila melanogaster. Biol. Lett. 10, 20140749 (2014).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Kossinets, G. & Watts, D. J. Empirical analysis of an evolving social network. Science 311, 88-90 (2006).

    Article  ADS  MathSciNet  CAS  PubMed  Google Scholar 

  55. Rubinov, M. & Sporns, O. Complex network measures of brain connectivity: Uses and interpretations. Neuroimage 52, 1059-1069 (2010).

    Article  PubMed  Google Scholar 

  56. Barolo, S., Carver, L. A. & Posakony, J. W. GFP and b-galactosidase transformation vectors for promoter/enhancer analysis in Drosophila. Biotechniques 29, 726-732 (2000).

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

These studies were funded by grants to J.D.L. from NSERC (RGPIN-2022-04765), CIHR (MOP-133659), CRC, and CIFAR. The authors wish to thank the following people for their help, comments and feedback: Josh Dubnau, Ralph Greenspan, Daniel Kronauer, Gene Robinson, Jean-Christophe Billeter, Michael Dickinson, Paul Taghert, Paul Breslin, Jacob Jezovit, Urfa Arain and Marla Sokolowski. The authors are especially thankful to Dr. Barbadilla and Dr. Hervás for their help and support with PopFly.

Author information

Authors and Affiliations

  1. Department of Biology, University of Toronto at Mississauga, 3359 Mississauga Rd. North, Mississauga, ON, L5L 1C6, Canada

    Rebecca Rooke, Joshua J. Krupp, Amara Rasool, Mireille Golemiec, Megan Stewart, Jonathan Schneider & Joel D. Levine

  2. Department of Ecology and Evolutionary Biology, University of Toronto, 25 Willcocks St., Toronto, ON, M5S 3B2, Canada

    Rebecca Rooke, Amara Rasool & Joel D. Levine

Contributions

R.R. and J.D.L. wrote the manuscript. J.J.K. and M.S. provided stained images of the muscle and CNS. R.R., M.G. and A.R. did social network experiments. R.R., J.S. and J.D.L. designed the experiments. J.D.L. supervised the work.

Corresponding author

Correspondence to Joel D. Levine.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Allen Moore and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Rooke, R., Krupp, J.J., Rasool, A. et al. The gene "degrees of kevin bacon" (dokb) regulates a social network behaviour in Drosophila melanogaster. Nat Commun 15, 3339 (2024). https://doi.org/10.1038/s41467-024-47499-8

Download citation

< Back to 68k.news BR front page